SDHAF2

$39 per sgRNA-expressing DNA construct

GENOME
Homo sapiens (human)
CHROMOSOME
chr11
AVERAGE REVIEWED TARGET EFFICIENCY
N/A
REVIEWS
0

Gene Description

This gene encodes a mitochondrial protein needed for the flavination of a succinate dehydrogenase complex subunit required for activity of the complex. Mutations in this gene are associated with paraganglioma.[provided by RefSeq, Jul 2010]

Product Includes

  • 5 ug of lentiviral expression DNA construct (LentiSH-Cas9-sgRNA-Puro) that express Cas9 and sgRNA targeting SDHAF2.
  • This construct can be co-transfected into mammalian cells with pSH-VSV-G and pSH-PAX2 to produce lentivirus, which can be used to infect and edit genes of your interests.


POSITION
SEQUENCE
SCORE
# OF MISMATCHES
PRICE
61205527
CGTTAATCAGGCGGTCATAG
94.4
0 Mismatches: 0
1 Mismatches: 0
2 Mismatches: 0
3 Mismatches: 12
39.00
Currently Available sgRNA-expressing DNA Constructs
POSITION
61205527
SEQUENCE
CGTTAATCAGGCGGTCATAG
SCORE
94.4
MISMATCHES
0 Mismatches: 0
1 Mismatches: 0
2 Mismatches: 0
3 Mismatches: 12
PRICE
39.00