AXIN2

$39 per sgRNA-expressing DNA construct

GENOME
Homo sapiens (human)
CHROMOSOME
chr17
AVERAGE REVIEWED TARGET EFFICIENCY
N/A
REVIEWS
0

Gene Description

The Axin-related protein, Axin2, presumably plays an important role in the regulation of the stability of beta-catenin in the Wnt signaling pathway, like its rodent homologs, mouse conductin/rat axil. In mouse, conductin organizes a multiprotein complex of APC (adenomatous polyposis of the colon), beta-catenin, glycogen synthase kinase 3-beta, and conductin, which leads to the degradation of beta-catenin. Apparently, the deregulation of beta-catenin is an important event in the genesis of a number of malignancies. The AXIN2 gene has been mapped to 17q23-q24, a region that shows frequent loss of heterozygosity in breast cancer, neuroblastoma, and other tumors. Mutations in this gene have been associated with colorectal cancer with defective mismatch repair. [provided by RefSeq, Jul 2008]

Product Includes

  • 5 ug of lentiviral expression DNA construct (LentiSH-Cas9-sgRNA-Puro) that express Cas9 and sgRNA targeting AXIN2.
  • This construct can be co-transfected into mammalian cells with pSH-VSV-G and pSH-PAX2 to produce lentivirus, which can be used to infect and edit genes of your interests.


POSITION
SEQUENCE
SCORE
# OF MISMATCHES
PRICE
63554791
AGACCACGCCGATTGCTGAG
93.0
0 Mismatches: 0
1 Mismatches: 0
2 Mismatches: 1
3 Mismatches: 13
39.00
Currently Available sgRNA-expressing DNA Constructs
POSITION
63554791
SEQUENCE
AGACCACGCCGATTGCTGAG
SCORE
93.0
MISMATCHES
0 Mismatches: 0
1 Mismatches: 0
2 Mismatches: 1
3 Mismatches: 13
PRICE
39.00