PHOX2B

$39 per sgRNA-expressing DNA construct

GENOME
Homo sapiens (human)
CHROMOSOME
chr4
AVERAGE REVIEWED TARGET EFFICIENCY
N/A
REVIEWS
0

Gene Description

The DNA-associated protein encoded by this gene is a member of the paired family of homeobox proteins localized to the nucleus. The protein functions as a transcription factor involved in the development of several major noradrenergic neuron populations and the determination of neurotransmitter phenotype. The gene product is linked to enhancement of second messenger-mediated activation of the dopamine beta-hydroylase, c-fos promoters and several enhancers, including cyclic amp-response element and serum-response element. Expansion of a 20 amino acid polyalanine tract in this protein by 5-13 aa has been associated with congenital central hypoventilation syndrome. [provided by RefSeq, Jul 2016]

Product Includes

  • 5 ug of lentiviral expression DNA construct (LentiSH-Cas9-sgRNA-Puro) that express Cas9 and sgRNA targeting PHOX2B.
  • This construct can be co-transfected into mammalian cells with pSH-VSV-G and pSH-PAX2 to produce lentivirus, which can be used to infect and edit genes of your interests.


POSITION
SEQUENCE
SCORE
# OF MISMATCHES
PRICE
41748303
CCGCGCCAAGTTTCGCAAGC
91.0
0 Mismatches: 0
1 Mismatches: 0
2 Mismatches: 0
3 Mismatches: 14
39.00
Currently Available sgRNA-expressing DNA Constructs
POSITION
41748303
SEQUENCE
CCGCGCCAAGTTTCGCAAGC
SCORE
91.0
MISMATCHES
0 Mismatches: 0
1 Mismatches: 0
2 Mismatches: 0
3 Mismatches: 14
PRICE
39.00