MPLKIP

$39 per sgRNA-expressing DNA construct

GENOME
Homo sapiens (human)
CHROMOSOME
chr7
AVERAGE REVIEWED TARGET EFFICIENCY
N/A
REVIEWS
0

Gene Description

The protein encoded by this gene localizes to the centrosome during mitosis and to the midbody during cytokinesis. The protein is phosphorylated by cyclin-dependent kinase 1 during mitosis and subsequently interacts with polo-like kinase 1. The protein is thought to function in regulating mitosis and cytokinesis. Mutations in this gene result in nonphotosensitive trichothiodystrophy. [provided by RefSeq, Nov 2009]

Product Includes

  • 5 ug of lentiviral expression DNA construct (LentiSH-Cas9-sgRNA-Puro) that express Cas9 and sgRNA targeting MPLKIP.
  • This construct can be co-transfected into mammalian cells with pSH-VSV-G and pSH-PAX2 to produce lentivirus, which can be used to infect and edit genes of your interests.


POSITION
SEQUENCE
SCORE
# OF MISMATCHES
PRICE
40174209
GCCGGTTGATACAGTTCCGG
87.0
0 Mismatches: 0
1 Mismatches: 0
2 Mismatches: 1
3 Mismatches: 19
39.00
Currently Available sgRNA-expressing DNA Constructs
POSITION
40174209
SEQUENCE
GCCGGTTGATACAGTTCCGG
SCORE
87.0
MISMATCHES
0 Mismatches: 0
1 Mismatches: 0
2 Mismatches: 1
3 Mismatches: 19
PRICE
39.00