WT1

$39 per sgRNA-expressing DNA construct

GENOME
Homo sapiens (human)
CHROMOSOME
chr11
AVERAGE REVIEWED TARGET EFFICIENCY
N/A
REVIEWS
0

Gene Description

This gene encodes a transcription factor that contains four zinc-finger motifs at the C-terminus and a proline/glutamine-rich DNA-binding domain at the N-terminus. It has an essential role in the normal development of the urogenital system, and it is mutated in a small subset of patients with Wilms tumor. This gene exhibits complex tissue-specific and polymorphic imprinting pattern, with biallelic, and monoallelic expression from the maternal and paternal alleles in different tissues. Multiple transcript variants have been described. In several variants, there is evidence for the use of a non-AUG (CUG) translation initiation codon upstream of, and in-frame with the first AUG. Authors of PMID:7926762 also provide evidence that WT1 mRNA undergoes RNA editing in human and rat, and that this process is tissue-restricted and developmentally regulated. [provided by RefSeq, Mar 2015]

Product Includes

  • 5 ug of lentiviral expression DNA construct (LentiSH-Cas9-sgRNA-Puro) that express Cas9 and sgRNA targeting WT1.
  • This construct can be co-transfected into mammalian cells with pSH-VSV-G and pSH-PAX2 to produce lentivirus, which can be used to infect and edit genes of your interests.


POSITION
SEQUENCE
SCORE
# OF MISMATCHES
PRICE
32450128
GTAGCTGGGCGTCCCGTCGA
96.4
0 Mismatches: 0
1 Mismatches: 0
2 Mismatches: 0
3 Mismatches: 12
39.00
Currently Available sgRNA-expressing DNA Constructs
POSITION
32450128
SEQUENCE
GTAGCTGGGCGTCCCGTCGA
SCORE
96.4
MISMATCHES
0 Mismatches: 0
1 Mismatches: 0
2 Mismatches: 0
3 Mismatches: 12
PRICE
39.00