STK11

$39 per sgRNA-expressing DNA construct

GENOME
Homo sapiens (human)
CHROMOSOME
chr19
AVERAGE REVIEWED TARGET EFFICIENCY
N/A
REVIEWS
0

Gene Description

This gene, which encodes a member of the serine/threonine kinase family, regulates cell polarity and functions as a tumor suppressor. Mutations in this gene have been associated with Peutz-Jeghers syndrome, an autosomal dominant disorder characterized by the growth of polyps in the gastrointestinal tract, pigmented macules on the skin and mouth, and other neoplasms. Alternate transcriptional splice variants of this gene have been observed but have not been thoroughly characterized. [provided by RefSeq, Jul 2008]

Product Includes

  • 5 ug of lentiviral expression DNA construct (LentiSH-Cas9-sgRNA-Puro) that express Cas9 and sgRNA targeting STK11.
  • This construct can be co-transfected into mammalian cells with pSH-VSV-G and pSH-PAX2 to produce lentivirus, which can be used to infect and edit genes of your interests.


POSITION
SEQUENCE
SCORE
# OF MISMATCHES
PRICE
1206107
CGCGCTCGGGCAGACGTTTG
95.3
0 Mismatches: 0
1 Mismatches: 0
2 Mismatches: 0
3 Mismatches: 9
39.00
Currently Available sgRNA-expressing DNA Constructs
POSITION
1206107
SEQUENCE
CGCGCTCGGGCAGACGTTTG
SCORE
95.3
MISMATCHES
0 Mismatches: 0
1 Mismatches: 0
2 Mismatches: 0
3 Mismatches: 9
PRICE
39.00