RHBDF2

$39 per sgRNA-expressing DNA construct

GENOME
Homo sapiens (human)
CHROMOSOME
chr17
AVERAGE REVIEWED TARGET EFFICIENCY
N/A
REVIEWS
0

Gene Description


RHBDF2 (Rhomboid 5 Homolog 2) is a Protein Coding gene.
Diseases associated with RHBDF2 include Tylosis With Esophageal Cancer and Esophageal Cancer.

GO annotations related to this gene include serine-type endopeptidase activity and growth factor binding.
An important paralog of this gene is RHBDF1.

Product Includes

  • 5 ug of lentiviral expression DNA construct (LentiSH-Cas9-sgRNA-Puro) that express Cas9 and sgRNA targeting RHBDF2.
  • This construct can be co-transfected into mammalian cells with pSH-VSV-G and pSH-PAX2 to produce lentivirus, which can be used to infect and edit genes of your interests.


POSITION
SEQUENCE
SCORE
# OF MISMATCHES
PRICE
74475256
CATGCGCTACGGCCGCCTGA
88.6
0 Mismatches: 0
1 Mismatches: 0
2 Mismatches: 0
3 Mismatches: 18
39.00
Currently Available sgRNA-expressing DNA Constructs
POSITION
74475256
SEQUENCE
CATGCGCTACGGCCGCCTGA
SCORE
88.6
MISMATCHES
0 Mismatches: 0
1 Mismatches: 0
2 Mismatches: 0
3 Mismatches: 18
PRICE
39.00