SLX4

$39 per sgRNA-expressing DNA construct

GENOME
Homo sapiens (human)
CHROMOSOME
chr16
AVERAGE REVIEWED TARGET EFFICIENCY
N/A
REVIEWS
0

Gene Description

This gene encodes a protein that functions as an assembly component of multiple structure-specific endonucleases. These endonuclease complexes are required for repair of specific types of DNA lesions and critical for cellular responses to replication fork failure. Mutations in this gene were found in patients with Fanconi anemia. [provided by RefSeq, Sep 2016]

Product Includes

  • 5 ug of lentiviral expression DNA construct (LentiSH-Cas9-sgRNA-Puro) that express Cas9 and sgRNA targeting SLX4.
  • This construct can be co-transfected into mammalian cells with pSH-VSV-G and pSH-PAX2 to produce lentivirus, which can be used to infect and edit genes of your interests.


POSITION
SEQUENCE
SCORE
# OF MISMATCHES
PRICE
3656553
AAGCGTGTCTCAAACGCTCG
85.7
0 Mismatches: 0
1 Mismatches: 0
2 Mismatches: 1
3 Mismatches: 46
39.00
Currently Available sgRNA-expressing DNA Constructs
POSITION
3656553
SEQUENCE
AAGCGTGTCTCAAACGCTCG
SCORE
85.7
MISMATCHES
0 Mismatches: 0
1 Mismatches: 0
2 Mismatches: 1
3 Mismatches: 46
PRICE
39.00