SMAD4

$39 per sgRNA-expressing DNA construct

GENOME
Homo sapiens (human)
CHROMOSOME
chr18
AVERAGE REVIEWED TARGET EFFICIENCY
N/A
REVIEWS
0

Gene Description

This gene encodes a member of the Smad family of signal transduction proteins. Smad proteins are phosphorylated and activated by transmembrane serine-threonine receptor kinases in response to transforming growth factor (TGF)-beta signaling. The product of this gene forms homomeric complexes and heteromeric complexes with other activated Smad proteins, which then accumulate in the nucleus and regulate the transcription of target genes. This protein binds to DNA and recognizes an 8-bp palindromic sequence (GTCTAGAC) called the Smad-binding element (SBE). The protein acts as a tumor suppressor and inhibits epithelial cell proliferation. It may also have an inhibitory effect on tumors by reducing angiogenesis and increasng blood vessel hyperpermeability. The encoded protein is a crucial component of the bone morphogenetic protein signaling pathway. The Smad proteins are subject to complex regulation by post-translational modifications. Mutations or deletions in this gene have been shown to result in pancreatic cancer, juvenile polyposis syndrome, and hereditary hemorrhagic telangiectasia syndrome. [provided by RefSeq, Aug 2017]

Product Includes

  • 5 ug of lentiviral expression DNA construct (LentiSH-Cas9-sgRNA-Puro) that express Cas9 and sgRNA targeting SMAD4.
  • This construct can be co-transfected into mammalian cells with pSH-VSV-G and pSH-PAX2 to produce lentivirus, which can be used to infect and edit genes of your interests.


POSITION
SEQUENCE
SCORE
# OF MISMATCHES
PRICE
48575197
ACAACTCGTTCGTAGTGATA
83.4
0 Mismatches: 0
1 Mismatches: 0
2 Mismatches: 0
3 Mismatches: 25
39.00
Currently Available sgRNA-expressing DNA Constructs
POSITION
48575197
SEQUENCE
ACAACTCGTTCGTAGTGATA
SCORE
83.4
MISMATCHES
0 Mismatches: 0
1 Mismatches: 0
2 Mismatches: 0
3 Mismatches: 25
PRICE
39.00