CSF1R

$39 per sgRNA-expressing DNA construct

GENOME
Homo sapiens (human)
CHROMOSOME
chr5
AVERAGE REVIEWED TARGET EFFICIENCY
N/A
REVIEWS
0

Gene Description

The protein encoded by this gene is the receptor for colony stimulating factor 1, a cytokine which controls the production, differentiation, and function of macrophages. This receptor mediates most if not all of the biological effects of this cytokine. Ligand binding activates the receptor kinase through a process of oligomerization and transphosphorylation. The encoded protein is a tyrosine kinase transmembrane receptor and member of the CSF1/PDGF receptor family of tyrosine-protein kinases. Mutations in this gene have been associated with a predisposition to myeloid malignancy. The first intron of this gene contains a transcriptionally inactive ribosomal protein L7 processed pseudogene oriented in the opposite direction. Alternative splicing results in multiple transcript variants. Expression of a splice variant from an LTR promoter has been found in Hodgkin lymphoma (HL), HL cell lines and anaplastic large cell lymphoma. [provided by RefSeq, Mar 2017]

Product Includes

  • 5 ug of lentiviral expression DNA construct (LentiSH-Cas9-sgRNA-Puro) that express Cas9 and sgRNA targeting CSF1R.
  • This construct can be co-transfected into mammalian cells with pSH-VSV-G and pSH-PAX2 to produce lentivirus, which can be used to infect and edit genes of your interests.


POSITION
SEQUENCE
SCORE
# OF MISMATCHES
PRICE
149460510
AACGGTGACCTTGCGATGTG
85.5
0 Mismatches: 0
1 Mismatches: 0
2 Mismatches: 2
3 Mismatches: 32
39.00
Currently Available sgRNA-expressing DNA Constructs
POSITION
149460510
SEQUENCE
AACGGTGACCTTGCGATGTG
SCORE
85.5
MISMATCHES
0 Mismatches: 0
1 Mismatches: 0
2 Mismatches: 2
3 Mismatches: 32
PRICE
39.00