CDKN1B

$39 per sgRNA-expressing DNA construct

GENOME
Homo sapiens (human)
CHROMOSOME
chr12
AVERAGE REVIEWED TARGET EFFICIENCY
N/A
REVIEWS
0

Gene Description

This gene encodes a cyclin-dependent kinase inhibitor, which shares a limited similarity with CDK inhibitor CDKN1A/p21. The encoded protein binds to and prevents the activation of cyclin E-CDK2 or cyclin D-CDK4 complexes, and thus controls the cell cycle progression at G1. The degradation of this protein, which is triggered by its CDK dependent phosphorylation and subsequent ubiquitination by SCF complexes, is required for the cellular transition from quiescence to the proliferative state. Mutations in this gene are associated with multiple endocrine neoplasia type IV (MEN4). [provided by RefSeq, Apr 2014]

Product Includes

  • 5 ug of lentiviral expression DNA construct (LentiSH-Cas9-sgRNA-Puro) that express Cas9 and sgRNA targeting CDKN1B.
  • This construct can be co-transfected into mammalian cells with pSH-VSV-G and pSH-PAX2 to produce lentivirus, which can be used to infect and edit genes of your interests.


POSITION
SEQUENCE
SCORE
# OF MISMATCHES
PRICE
12870415
ACTCCGACGCCGGCAAGGTT
89.8
0 Mismatches: 0
1 Mismatches: 0
2 Mismatches: 0
3 Mismatches: 12
39.00
Currently Available sgRNA-expressing DNA Constructs
POSITION
12870415
SEQUENCE
ACTCCGACGCCGGCAAGGTT
SCORE
89.8
MISMATCHES
0 Mismatches: 0
1 Mismatches: 0
2 Mismatches: 0
3 Mismatches: 12
PRICE
39.00