RBM15

$39 per sgRNA-expressing DNA construct

GENOME
Homo sapiens (human)
CHROMOSOME
chr1
AVERAGE REVIEWED TARGET EFFICIENCY
N/A
REVIEWS
0

Gene Description

Members of the SPEN (Split-end) family of proteins, including RBM15, have repressor function in several signaling pathways and may bind to RNA through interaction with spliceosome components (Hiriart et al., 2005 [PubMed 16129689]).[supplied by OMIM, Feb 2009]

Product Includes

  • 5 ug of lentiviral expression DNA construct (LentiSH-Cas9-sgRNA-Puro) that express Cas9 and sgRNA targeting RBM15.
  • This construct can be co-transfected into mammalian cells with pSH-VSV-G and pSH-PAX2 to produce lentivirus, which can be used to infect and edit genes of your interests.


POSITION
SEQUENCE
SCORE
# OF MISMATCHES
PRICE
110882089
CGCTGTGTGAAACGAGCGCG
95.7
0 Mismatches: 0
1 Mismatches: 0
2 Mismatches: 1
3 Mismatches: 3
39.00
Currently Available sgRNA-expressing DNA Constructs
POSITION
110882089
SEQUENCE
CGCTGTGTGAAACGAGCGCG
SCORE
95.7
MISMATCHES
0 Mismatches: 0
1 Mismatches: 0
2 Mismatches: 1
3 Mismatches: 3
PRICE
39.00