GPC3

$39 per sgRNA-expressing DNA construct

GENOME
Homo sapiens (human)
CHROMOSOME
chrX
AVERAGE REVIEWED TARGET EFFICIENCY
N/A
REVIEWS
0

Gene Description

Cell surface heparan sulfate proteoglycans are composed of a membrane-associated protein core substituted with a variable number of heparan sulfate chains. Members of the glypican-related integral membrane proteoglycan family (GRIPS) contain a core protein anchored to the cytoplasmic membrane via a glycosyl phosphatidylinositol linkage. These proteins may play a role in the control of cell division and growth regulation. The protein encoded by this gene can bind to and inhibit the dipeptidyl peptidase activity of CD26, and it can induce apoptosis in certain cell types. Deletion mutations in this gene are associated with Simpson-Golabi-Behmel syndrome, also known as Simpson dysmorphia syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]

Product Includes

  • 5 ug of lentiviral expression DNA construct (LentiSH-Cas9-sgRNA-Puro) that express Cas9 and sgRNA targeting GPC3.
  • This construct can be co-transfected into mammalian cells with pSH-VSV-G and pSH-PAX2 to produce lentivirus, which can be used to infect and edit genes of your interests.


POSITION
SEQUENCE
SCORE
# OF MISMATCHES
PRICE
133119632
CGAGGGCGGGAACCGCTTGG
88.4
0 Mismatches: 0
1 Mismatches: 0
2 Mismatches: 1
3 Mismatches: 31
39.00
Currently Available sgRNA-expressing DNA Constructs
POSITION
133119632
SEQUENCE
CGAGGGCGGGAACCGCTTGG
SCORE
88.4
MISMATCHES
0 Mismatches: 0
1 Mismatches: 0
2 Mismatches: 1
3 Mismatches: 31
PRICE
39.00