HRAS

$39 per sgRNA-expressing DNA construct

GENOME
Homo sapiens (human)
CHROMOSOME
chr11
AVERAGE REVIEWED TARGET EFFICIENCY
N/A
REVIEWS
0

Gene Description

This gene belongs to the Ras oncogene family, whose members are related to the transforming genes of mammalian sarcoma retroviruses. The products encoded by these genes function in signal transduction pathways. These proteins can bind GTP and GDP, and they have intrinsic GTPase activity. This protein undergoes a continuous cycle of de- and re-palmitoylation, which regulates its rapid exchange between the plasma membrane and the Golgi apparatus. Mutations in this gene cause Costello syndrome, a disease characterized by increased growth at the prenatal stage, growth deficiency at the postnatal stage, predisposition to tumor formation, cognitive disability, skin and musculoskeletal abnormalities, distinctive facial appearance and cardiovascular abnormalities. Defects in this gene are implicated in a variety of cancers, including bladder cancer, follicular thyroid cancer, and oral squamous cell carcinoma. Multiple transcript variants, which encode different isoforms, have been identified for this gene. [provided by RefSeq, Jul 2008]

Product Includes

  • 5 ug of lentiviral expression DNA construct (LentiSH-Cas9-sgRNA-Puro) that express Cas9 and sgRNA targeting HRAS.
  • This construct can be co-transfected into mammalian cells with pSH-VSV-G and pSH-PAX2 to produce lentivirus, which can be used to infect and edit genes of your interests.


POSITION
SEQUENCE
SCORE
# OF MISMATCHES
PRICE
535499
CGCGGACGGAGCCCATGCGC
89.7
0 Mismatches: 0
1 Mismatches: 0
2 Mismatches: 2
3 Mismatches: 15
39.00
Currently Available sgRNA-expressing DNA Constructs
POSITION
535499
SEQUENCE
CGCGGACGGAGCCCATGCGC
SCORE
89.7
MISMATCHES
0 Mismatches: 0
1 Mismatches: 0
2 Mismatches: 2
3 Mismatches: 15
PRICE
39.00