DDB2

$39 per sgRNA-expressing DNA construct

GENOME
Homo sapiens (human)
CHROMOSOME
chr11
AVERAGE REVIEWED TARGET EFFICIENCY
N/A
REVIEWS
0

Gene Description

This gene encodes a protein that is necessary for the repair of ultraviolet light-damaged DNA. This protein is the smaller subunit of a heterodimeric protein complex that participates in nucleotide excision repair, and this complex mediates the ubiquitylation of histones H3 and H4, which facilitates the cellular response to DNA damage. This subunit appears to be required for DNA binding. Mutations in this gene cause xeroderma pigmentosum complementation group E, a recessive disease that is characterized by an increased sensitivity to UV light and a high predisposition for skin cancer development, in some cases accompanied by neurological abnormalities. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]

Product Includes

  • 5 ug of lentiviral expression DNA construct (LentiSH-Cas9-sgRNA-Puro) that express Cas9 and sgRNA targeting DDB2.
  • This construct can be co-transfected into mammalian cells with pSH-VSV-G and pSH-PAX2 to produce lentivirus, which can be used to infect and edit genes of your interests.


POSITION
SEQUENCE
SCORE
# OF MISMATCHES
PRICE
47236670
ATCGCGTCCTCCGTGTGAAG
84.5
0 Mismatches: 0
1 Mismatches: 0
2 Mismatches: 1
3 Mismatches: 20
39.00
Currently Available sgRNA-expressing DNA Constructs
POSITION
47236670
SEQUENCE
ATCGCGTCCTCCGTGTGAAG
SCORE
84.5
MISMATCHES
0 Mismatches: 0
1 Mismatches: 0
2 Mismatches: 1
3 Mismatches: 20
PRICE
39.00