BRAF

$39 per sgRNA-expressing DNA construct

GENOME
Homo sapiens (human)
CHROMOSOME
chr7
AVERAGE REVIEWED TARGET EFFICIENCY
N/A
REVIEWS
0

Gene Description

This gene encodes a protein belonging to the RAF family of serine/threonine protein kinases. This protein plays a role in regulating the MAP kinase/ERK signaling pathway, which affects cell division, differentiation, and secretion. Mutations in this gene, most commonly the V600E mutation, are the most frequently identified cancer-causing mutations in melanoma, and have been identified in various other cancers as well, including non-Hodgkin lymphoma, colorectal cancer, thyroid carcinoma, non-small cell lung carcinoma, hairy cell leukemia and adenocarcinoma of lung. Mutations in this gene are also associated with cardiofaciocutaneous, Noonan, and Costello syndromes, which exhibit overlapping phenotypes. A pseudogene of this gene has been identified on the X chromosome. [provided by RefSeq, Aug 2017]

Product Includes

  • 5 ug of lentiviral expression DNA construct (LentiSH-Cas9-sgRNA-Puro) that express Cas9 and sgRNA targeting BRAF.
  • This construct can be co-transfected into mammalian cells with pSH-VSV-G and pSH-PAX2 to produce lentivirus, which can be used to infect and edit genes of your interests.


POSITION
SEQUENCE
SCORE
# OF MISMATCHES
PRICE
140624501
CATCTTATAACCGAGAGCCG
87.1
0 Mismatches: 0
1 Mismatches: 0
2 Mismatches: 2
3 Mismatches: 27
39.00
Currently Available sgRNA-expressing DNA Constructs
POSITION
140624501
SEQUENCE
CATCTTATAACCGAGAGCCG
SCORE
87.1
MISMATCHES
0 Mismatches: 0
1 Mismatches: 0
2 Mismatches: 2
3 Mismatches: 27
PRICE
39.00