AIP

$39 per sgRNA-expressing DNA construct

GENOME
Homo sapiens (human)
CHROMOSOME
chr11
AVERAGE REVIEWED TARGET EFFICIENCY
N/A
REVIEWS
0

Gene Description

The protein encoded by this gene is a receptor for aryl hydrocarbons and a ligand-activated transcription factor. The encoded protein is found in the cytoplasm as part of a multiprotein complex, but upon binding of ligand is transported to the nucleus. This protein can regulate the expression of many xenobiotic metabolizing enzymes. Also, the encoded protein can bind specifically to and inhibit the activity of hepatitis B virus. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2014]

Product Includes

  • 5 ug of lentiviral expression DNA construct (LentiSH-Cas9-sgRNA-Puro) that express Cas9 and sgRNA targeting AIP.
  • This construct can be co-transfected into mammalian cells with pSH-VSV-G and pSH-PAX2 to produce lentivirus, which can be used to infect and edit genes of your interests.


POSITION
SEQUENCE
SCORE
# OF MISMATCHES
PRICE
67250577
CGGACTCGCTCGGTAGCTTC
95.3
0 Mismatches: 0
1 Mismatches: 0
2 Mismatches: 0
3 Mismatches: 9
39.00
Currently Available sgRNA-expressing DNA Constructs
POSITION
67250577
SEQUENCE
CGGACTCGCTCGGTAGCTTC
SCORE
95.3
MISMATCHES
0 Mismatches: 0
1 Mismatches: 0
2 Mismatches: 0
3 Mismatches: 9
PRICE
39.00