JAK3

$39 per sgRNA-expressing DNA construct

GENOME
Homo sapiens (human)
CHROMOSOME
chr19
AVERAGE REVIEWED TARGET EFFICIENCY
N/A
REVIEWS
0

Gene Description

The protein encoded by this gene is a member of the Janus kinase (JAK) family of tyrosine kinases involved in cytokine receptor-mediated intracellular signal transduction. It is predominantly expressed in immune cells and transduces a signal in response to its activation via tyrosine phosphorylation by interleukin receptors. Mutations in this gene are associated with autosomal SCID (severe combined immunodeficiency disease). [provided by RefSeq, Jul 2008]

Product Includes

  • 5 ug of lentiviral expression DNA construct (LentiSH-Cas9-sgRNA-Puro) that express Cas9 and sgRNA targeting JAK3.
  • This construct can be co-transfected into mammalian cells with pSH-VSV-G and pSH-PAX2 to produce lentivirus, which can be used to infect and edit genes of your interests.


POSITION
SEQUENCE
SCORE
# OF MISMATCHES
PRICE
17958773
TGCCCGCCCTTCGAAAGTCC
88.7
0 Mismatches: 0
1 Mismatches: 0
2 Mismatches: 0
3 Mismatches: 32
39.00
Currently Available sgRNA-expressing DNA Constructs
POSITION
17958773
SEQUENCE
TGCCCGCCCTTCGAAAGTCC
SCORE
88.7
MISMATCHES
0 Mismatches: 0
1 Mismatches: 0
2 Mismatches: 0
3 Mismatches: 32
PRICE
39.00