CDH1

$39 per sgRNA-expressing DNA construct

GENOME
Homo sapiens (human)
CHROMOSOME
chr16
AVERAGE REVIEWED TARGET EFFICIENCY
N/A
REVIEWS
0

Gene Description

This gene encodes a classical cadherin of the cadherin superfamily. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate the mature glycoprotein. This calcium-dependent cell-cell adhesion protein is comprised of five extracellular cadherin repeats, a transmembrane region and a highly conserved cytoplasmic tail. Mutations in this gene are correlated with gastric, breast, colorectal, thyroid and ovarian cancer. Loss of function of this gene is thought to contribute to cancer progression by increasing proliferation, invasion, and/or metastasis. The ectodomain of this protein mediates bacterial adhesion to mammalian cells and the cytoplasmic domain is required for internalization. This gene is present in a gene cluster with other members of the cadherin family on chromosome 16. [provided by RefSeq, Nov 2015]

Product Includes

  • 5 ug of lentiviral expression DNA construct (LentiSH-Cas9-sgRNA-Puro) that express Cas9 and sgRNA targeting CDH1.
  • This construct can be co-transfected into mammalian cells with pSH-VSV-G and pSH-PAX2 to produce lentivirus, which can be used to infect and edit genes of your interests.


POSITION
SEQUENCE
SCORE
# OF MISMATCHES
PRICE
68835582
AAGATTGCACCGGTCGACAA
97.1
0 Mismatches: 0
1 Mismatches: 0
2 Mismatches: 0
3 Mismatches: 19
39.00
Currently Available sgRNA-expressing DNA Constructs
POSITION
68835582
SEQUENCE
AAGATTGCACCGGTCGACAA
SCORE
97.1
MISMATCHES
0 Mismatches: 0
1 Mismatches: 0
2 Mismatches: 0
3 Mismatches: 19
PRICE
39.00