NPM1

$39 per sgRNA-expressing DNA construct

GENOME
Homo sapiens (human)
CHROMOSOME
chr5
AVERAGE REVIEWED TARGET EFFICIENCY
N/A
REVIEWS
0

Gene Description

The protein encoded by this gene is involved in several cellular processes, including centrosome duplication, protein chaperoning, and cell proliferation. The encoded phosphoprotein shuttles between the nucleolus, nucleus, and cytoplasm, chaperoning ribosomal proteins and core histones from the nucleus to the cytoplasm. This protein is also known to sequester the tumor suppressor ARF in the nucleolus, protecting it from degradation until it is needed. Mutations in this gene are associated with acute myeloid leukemia. Dozens of pseudogenes of this gene have been identified. [provided by RefSeq, Aug 2017]

Product Includes

  • 5 ug of lentiviral expression DNA construct (LentiSH-Cas9-sgRNA-Puro) that express Cas9 and sgRNA targeting NPM1.
  • This construct can be co-transfected into mammalian cells with pSH-VSV-G and pSH-PAX2 to produce lentivirus, which can be used to infect and edit genes of your interests.


POSITION
SEQUENCE
SCORE
# OF MISMATCHES
PRICE
170814737
GCAGGACGGCTACGGTACGG
99.1
0 Mismatches: 0
1 Mismatches: 0
2 Mismatches: 1
3 Mismatches: 5
39.00
Currently Available sgRNA-expressing DNA Constructs
POSITION
170814737
SEQUENCE
GCAGGACGGCTACGGTACGG
SCORE
99.1
MISMATCHES
0 Mismatches: 0
1 Mismatches: 0
2 Mismatches: 1
3 Mismatches: 5
PRICE
39.00