KIT

$39 per sgRNA-expressing DNA construct

GENOME
Homo sapiens (human)
CHROMOSOME
chr4
AVERAGE REVIEWED TARGET EFFICIENCY
N/A
REVIEWS
0

Gene Description

This gene encodes the human homolog of the proto-oncogene c-kit. C-kit was first identified as the cellular homolog of the feline sarcoma viral oncogene v-kit. This protein is a type 3 transmembrane receptor for MGF (mast cell growth factor, also known as stem cell factor). Mutations in this gene are associated with gastrointestinal stromal tumors, mast cell disease, acute myelogenous lukemia, and piebaldism. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Product Includes

  • 5 ug of lentiviral expression DNA construct (LentiSH-Cas9-sgRNA-Puro) that express Cas9 and sgRNA targeting KIT.
  • This construct can be co-transfected into mammalian cells with pSH-VSV-G and pSH-PAX2 to produce lentivirus, which can be used to infect and edit genes of your interests.


POSITION
SEQUENCE
SCORE
# OF MISMATCHES
PRICE
55524176
ACCGCGATGAGAGGCGCTCG
95.3
0 Mismatches: 0
1 Mismatches: 0
2 Mismatches: 0
3 Mismatches: 9
39.00
Currently Available sgRNA-expressing DNA Constructs
POSITION
55524176
SEQUENCE
ACCGCGATGAGAGGCGCTCG
SCORE
95.3
MISMATCHES
0 Mismatches: 0
1 Mismatches: 0
2 Mismatches: 0
3 Mismatches: 9
PRICE
39.00