CEBPA

$39 per sgRNA-expressing DNA construct

GENOME
Homo sapiens (human)
CHROMOSOME
chr19
AVERAGE REVIEWED TARGET EFFICIENCY
N/A
REVIEWS
0

Gene Description

This intronless gene encodes a transcription factor that contains a basic leucine zipper (bZIP) domain and recognizes the CCAAT motif in the promoters of target genes. The encoded protein functions in homodimers and also heterodimers with CCAAT/enhancer-binding proteins beta and gamma. Activity of this protein can modulate the expression of genes involved in cell cycle regulation as well as in body weight homeostasis. Mutation of this gene is associated with acute myeloid leukemia. The use of alternative in-frame non-AUG (GUG) and AUG start codons results in protein isoforms with different lengths. Differential translation initiation is mediated by an out-of-frame, upstream open reading frame which is located between the GUG and the first AUG start codons. [provided by RefSeq, Dec 2013]

Product Includes

  • 5 ug of lentiviral expression DNA construct (LentiSH-Cas9-sgRNA-Puro) that express Cas9 and sgRNA targeting CEBPA.
  • This construct can be co-transfected into mammalian cells with pSH-VSV-G and pSH-PAX2 to produce lentivirus, which can be used to infect and edit genes of your interests.


POSITION
SEQUENCE
SCORE
# OF MISMATCHES
PRICE
33793299
GGAGTCGGCCGACTTCTACG
94.4
0 Mismatches: 0
1 Mismatches: 0
2 Mismatches: 0
3 Mismatches: 16
39.00
Currently Available sgRNA-expressing DNA Constructs
POSITION
33793299
SEQUENCE
GGAGTCGGCCGACTTCTACG
SCORE
94.4
MISMATCHES
0 Mismatches: 0
1 Mismatches: 0
2 Mismatches: 0
3 Mismatches: 16
PRICE
39.00