SMARCB1

$39 per sgRNA-expressing DNA construct

GENOME
Homo sapiens (human)
CHROMOSOME
chr22
AVERAGE REVIEWED TARGET EFFICIENCY
N/A
REVIEWS
0

Gene Description

The protein encoded by this gene is part of a complex that relieves repressive chromatin structures, allowing the transcriptional machinery to access its targets more effectively. The encoded nuclear protein may also bind to and enhance the DNA joining activity of HIV-1 integrase. This gene has been found to be a tumor suppressor, and mutations in it have been associated with malignant rhabdoid tumors. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2015]

Product Includes

  • 5 ug of lentiviral expression DNA construct (LentiSH-Cas9-sgRNA-Puro) that express Cas9 and sgRNA targeting SMARCB1.
  • This construct can be co-transfected into mammalian cells with pSH-VSV-G and pSH-PAX2 to produce lentivirus, which can be used to infect and edit genes of your interests.


POSITION
SEQUENCE
SCORE
# OF MISMATCHES
PRICE
24133949
AACTACCTCCGTATGTTCCG
95.2
0 Mismatches: 0
1 Mismatches: 0
2 Mismatches: 0
3 Mismatches: 11
39.00
Currently Available sgRNA-expressing DNA Constructs
POSITION
24133949
SEQUENCE
AACTACCTCCGTATGTTCCG
SCORE
95.2
MISMATCHES
0 Mismatches: 0
1 Mismatches: 0
2 Mismatches: 0
3 Mismatches: 11
PRICE
39.00