SDHB

$39 per sgRNA-expressing DNA construct

GENOME
Homo sapiens (human)
CHROMOSOME
chr1
AVERAGE REVIEWED TARGET EFFICIENCY
N/A
REVIEWS
0

Gene Description

Complex II of the respiratory chain, which is specifically involved in the oxidation of succinate, carries electrons from FADH to CoQ. The complex is composed of four nuclear-encoded subunits and is localized in the mitochondrial inner membrane. The iron-sulfur subunit is highly conserved and contains three cysteine-rich clusters which may comprise the iron-sulfur centers of the enzyme. Sporadic and familial mutations in this gene result in paragangliomas and pheochromocytoma, and support a link between mitochondrial dysfunction and tumorigenesis. [provided by RefSeq, Jul 2008]

Product Includes

  • 5 ug of lentiviral expression DNA construct (LentiSH-Cas9-sgRNA-Puro) that express Cas9 and sgRNA targeting SDHB.
  • This construct can be co-transfected into mammalian cells with pSH-VSV-G and pSH-PAX2 to produce lentivirus, which can be used to infect and edit genes of your interests.


POSITION
SEQUENCE
SCORE
# OF MISMATCHES
PRICE
17380616
GGTTGCTCGTACGCGGCTAG
100.0
0 Mismatches: 0
1 Mismatches: 0
2 Mismatches: 0
3 Mismatches: 0
39.00
Currently Available sgRNA-expressing DNA Constructs
POSITION
17380616
SEQUENCE
GGTTGCTCGTACGCGGCTAG
SCORE
100.0
MISMATCHES
0 Mismatches: 0
1 Mismatches: 0
2 Mismatches: 0
3 Mismatches: 0
PRICE
39.00