GTF2H5

$39 per sgRNA-expressing DNA construct

GENOME
Homo sapiens (human)
CHROMOSOME
chr6
AVERAGE REVIEWED TARGET EFFICIENCY
N/A
REVIEWS
0

Gene Description

This gene encodes a subunit of transcription/repair factor TFIIH, which functions in gene transcription and DNA repair. This protein stimulates ERCC3/XPB ATPase activity to trigger DNA opening during DNA repair, and is implicated in regulating cellular levels of TFIIH. Mutations in this gene result in trichothiodystrophy, complementation group A. [provided by RefSeq, Mar 2009]

Product Includes

  • 5 ug of lentiviral expression DNA construct (LentiSH-Cas9-sgRNA-Puro) that express Cas9 and sgRNA targeting GTF2H5.
  • This construct can be co-transfected into mammalian cells with pSH-VSV-G and pSH-PAX2 to produce lentivirus, which can be used to infect and edit genes of your interests.


POSITION
SEQUENCE
SCORE
# OF MISMATCHES
PRICE
158589382
GCACTCTGCCGGCAACGCCG
85.2
0 Mismatches: 0
1 Mismatches: 0
2 Mismatches: 1
3 Mismatches: 30
39.00
Currently Available sgRNA-expressing DNA Constructs
POSITION
158589382
SEQUENCE
GCACTCTGCCGGCAACGCCG
SCORE
85.2
MISMATCHES
0 Mismatches: 0
1 Mismatches: 0
2 Mismatches: 1
3 Mismatches: 30
PRICE
39.00