SDHD

$39 per sgRNA-expressing DNA construct

GENOME
Homo sapiens (human)
CHROMOSOME
chr11
AVERAGE REVIEWED TARGET EFFICIENCY
N/A
REVIEWS
0

Gene Description

This gene encodes a member of complex II of the respiratory chain, which is responsible for the oxidation of succinate. The encoded protein is one of two integral membrane proteins anchoring the complex to the matrix side of the mitochondrial inner membrane. Mutations in this gene are associated with the formation of tumors, including hereditary paraganglioma. Transmission of disease occurs almost exclusively through the paternal allele, suggesting that this locus may be maternally imprinted. There are pseudogenes for this gene on chromosomes 1, 2, 3, 7, and 18. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2013]

Product Includes

  • 5 ug of lentiviral expression DNA construct (LentiSH-Cas9-sgRNA-Puro) that express Cas9 and sgRNA targeting SDHD.
  • This construct can be co-transfected into mammalian cells with pSH-VSV-G and pSH-PAX2 to produce lentivirus, which can be used to infect and edit genes of your interests.


POSITION
SEQUENCE
SCORE
# OF MISMATCHES
PRICE
111957553
TTTCTTTCGTCGTCGTGGGT
89.3
0 Mismatches: 0
1 Mismatches: 0
2 Mismatches: 1
3 Mismatches: 31
39.00
Currently Available sgRNA-expressing DNA Constructs
POSITION
111957553
SEQUENCE
TTTCTTTCGTCGTCGTGGGT
SCORE
89.3
MISMATCHES
0 Mismatches: 0
1 Mismatches: 0
2 Mismatches: 1
3 Mismatches: 31
PRICE
39.00