POLD1

$39 per sgRNA-expressing DNA construct

GENOME
Homo sapiens (human)
CHROMOSOME
chr19
AVERAGE REVIEWED TARGET EFFICIENCY
N/A
REVIEWS
0

Gene Description

This gene encodes the 125-kDa catalytic subunit of DNA polymerase delta. DNA polymerase delta possesses both polymerase and 3' to 5' exonuclease activity and plays a critical role in DNA replication and repair. Alternatively spliced transcript variants have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 6. [provided by RefSeq, Mar 2012]

Product Includes

  • 5 ug of lentiviral expression DNA construct (LentiSH-Cas9-sgRNA-Puro) that express Cas9 and sgRNA targeting POLD1.
  • This construct can be co-transfected into mammalian cells with pSH-VSV-G and pSH-PAX2 to produce lentivirus, which can be used to infect and edit genes of your interests.


POSITION
SEQUENCE
SCORE
# OF MISMATCHES
PRICE
50902195
TCGGCCATCCCAATTCGAGG
90.2
0 Mismatches: 0
1 Mismatches: 0
2 Mismatches: 0
3 Mismatches: 18
39.00
Currently Available sgRNA-expressing DNA Constructs
POSITION
50902195
SEQUENCE
TCGGCCATCCCAATTCGAGG
SCORE
90.2
MISMATCHES
0 Mismatches: 0
1 Mismatches: 0
2 Mismatches: 0
3 Mismatches: 18
PRICE
39.00